chapter 8 redis a key value store
Tài liệu Practical mod_perl-CHAPTER 8:Choosing a Platform for the Best Performance docx
Ngày tải lên :
26/01/2014, 07:20
... may also be to get adequate disk capacity or high reliability Redundancy means that the system is capable of continued operation even if a disk fails There are various types of RAID arrays and ... lot of read/write operations to disk) you need a very fast disk, especially when using a relational database Don’t spend the money on a fancy video card and monitor! A cheap card and a 14-inch ... down Load balancing Say that users are given the name of one of your machines, but it cannot stand the heavy load You can use a clustering approach to distribute the load over a number of machines...
- 10
- 337
- 0
Tài liệu Updating a Primary Key Value pdf
Ngày tải lên :
26/01/2014, 10:20
... Id value Updating the primary key in a database is not normally necessary Some RDBMSs not support updating the primary key Additionally, if a data relation is based on the primary key, related ... original values for the row Not available for rows that have been added Original since data was last retrieved from data source or since AcceptChanges( ) was last called Proposed The proposed values ... Only available after BeginEdit( ) is called for the DataRow( ) until EndEdit( ) or CancelEdit( ) is called To change the primary key in the table in the database, the UpdateCommand of the DataAdapter...
- 5
- 273
- 0
ECOTOXICOLOGY: A Comprehensive Treatment - Chapter 8 potx
Ngày tải lên :
18/06/2014, 16:20
... formulations: rate-constant-based, clearance-volumebased, and fugacity-based formulations All are equivalent in their basic forms, but each formulation has its own advantages and disadvantages (Newman and ... Cahill et al (2003), Czub and McLachlan (2004), Gobas and Mackay (1987), Hickie et al (1999), Mackay (1979, 2001), Mackay and Wania (1995), and Wania and Mackay (1995) As described above in Mackay’s ... transfer to human milk At a subcontinental scale, Mackay and Wania modeled the movement of organochlorine contaminants in the Arctic General (Wania and Mackay 1995) and chemical-specific (Wania...
- 19
- 426
- 0
WETLAND AND WATER RESOURCE MODELING AND ASSESSMENT: A Watershed Perspective - Chapter 8 doc
Ngày tải lên :
18/06/2014, 16:20
... Assessment TABLE 8.1 Model parameters after calibration Parameter Description Value m SRMAX td Smaxsf Exponential storage parameter Root zone available water capacity Unsaturated zone time delay per ... 1987 Additional data of pan evaporation and stream discharge from the observation station of the catchment outlet are used for model parameter calibration and model validation Precipitation Station ... daily precipitation, pan evaporation, and stream discharge from 1982 to 1985 are selected for model parameter calibration, and the daily data from 1986 to 1987 for model validation Additionally,...
- 10
- 393
- 0
A Practical Guide to Particle Counting for Drinking Water Treatment - Chapter 8 ppt
Ngày tải lên :
18/06/2014, 19:20
... comparator input stage The more complex approach involves analog-to-digital (A/ D) conversion Voltage Comparator A comparator is simply a small circuit that “compares” an input signal to a fixed ... not be an issue of great importance As far as the operator is concerned, the units operate the same way from a functional standpoint As standards are developed and become defined to a greater degree, ... typically communicated every minute The comparator provides a simple way to convert the particle size information from an analog pulse to a digital count value It is a very basic form of analog-todigital...
- 7
- 372
- 1
SAFE USE OF CHEMICALS: A Practical Guide - Chapter 8 ppt
Ngày tải lên :
18/06/2014, 22:20
... Hemangioma Lymphangioma Hemangiosarcoma Lymphangiosarcoma Glandular Squamous Transitional Epithelium Adenoma Squamous cell papilloma Transitional cell papilloma Adenocarcinoma Squamous cell carcinoma ... D: not classifiable as to human carcinogenicity This group includes agents with inadequate human and animal evidence of carcinogenicity or no data available in animals and/or humans Group E: evidence ... 162 Safe Use of Chemicals: A Practical Guide cobalt, and chromium Only two minerals are known to cause cancer: asbestos and arsenic Naturally occurring Several naturally occurring carcinogens are...
- 12
- 447
- 0
Basic Marketing: A Global−Managerial Approach Chapter 8 docx
Ngày tải lên :
01/07/2014, 20:20
... data is available and accessible quickly Marketing managers deal with rapidly changing environments Available data is not always adequate to answer the detailed questions that arise Then a marketing ... Much secondary data is available Ideally, much secondary data is already available from the firm’s MIS Data that has not been organized in an MIS may be available from the company’s files and reports ... For example, the American Marketing Association (www.ama.org) has an information center with many marketing publications Perreault−McCarthy: Basic Marketing: A Global−Managerial Approach, 14/e...
- 30
- 674
- 0
MBA In A Day Chapter 8 ppsx
Ngày tải lên :
01/07/2014, 22:20
... Professionals (SCIP), a systematic and ethical program for gathering, analyzing, and managing external information that can affect [the firm’s] plans, decisions, and operations Specifically, [CI] ... to Attack and Avoid Some competitors are such large financial powerhouses that it may not be financially feasible to attack Some merely put up the front or the image that they cannot be attacked ... service Value Chain All of the aforementioned parts of the marketing plan cannot be carried out to the full level of effectiveness without all areas a value chain—working together Generally, the value...
- 27
- 397
- 0
A New Ecology - Systems Perspective - Chapter 8 docx
Ngày tải lên :
04/07/2014, 13:20
... 1883 by a catastrophic volcanic explosion that devastated the island of Krakatau, located between the islands of Sumatra and Java The flora and fauna of its remnant and of two adjacent islands were ... both oceans was solar energy input, as represented by average sea surface temperature Moreover, these authors claim that if that correlation was causal, sea surface temperature is probably linked ... climatically similar total surface area than landmasses at higher latitudes with similarly small temperature fluctuations (Rosenzweig, 1992) This may be related to higher levels of speciation and...
- 32
- 431
- 0
A Prince of Sinners E. Phillips Oppenheim BOOK 1 CHAPTER 8 docx
Ngày tải lên :
06/07/2014, 02:20
... one of sympathy, but it may at any rate save me from having my carriage windows broken one dark night By the bye, I have ordered a brougham for you in half-an-hour As you see, it is raining Your ... his face-something underneath seemed struggling for expression In a second it had all passed away Brooks could almost have persuaded himself that it was fancy "Come for something to eat, Arranmore," ... beggar! I fancy that he was hard up, for one thing." To Brooks the subject was fascinating, but he had an idea that it was scarcely the best of form to be discussing their late host with a man...
- 10
- 271
- 0
A Companion to the History of Economic Thought - Chapter 8 ppsx
Ngày tải lên :
06/07/2014, 02:20
... contemporaries and successors Even if capital amortization were treated as payments to stored-up labor, relative values could change without any change in labor input, if the capital–labor ratios ... of capital and the nature of profit Torrens adopted a different approach and argued that relative amounts of capital, rather than labor, determined relative price However, since the valuation of ... classical analysis, a tax on wage goods was generally to be passed on, implying that it increased the size of the wage fund), and the division of a given stock of capital between fixed and variable...
- 18
- 466
- 0
A Prince of Sinners E. Phillips Oppenheim BOOK 2 CHAPTER 8 doc
Ngày tải lên :
06/07/2014, 05:20
... "My dear Peter," she said, "I think we're very comfortable as we are A larger household means more care, and a man-servant about the place is a thing I could never abide If you felt like taking ... knew what I was about, and so did the others Mason made nearly as much as I did." Selina looked at her father with a new respect He rose and brushed the ashes of his cigar from his waistcoat "Now ... men are all pleasant enough," Mr Bullsom remarked "I meet them in the trains and in business, and they're always glad enough to pass the time o' day." "Oh, the men are all right," Selina answered...
- 12
- 247
- 0
A Prince of Sinners E. Phillips Oppenheim BOOK 3 CHAPTER 8 pot
Ngày tải lên :
06/07/2014, 05:20
... he's made a mistake, and who isn't willing to start again on a fresh page You take my advice, Brooks Be reconciled with your father, and let 'em all know who you are I've seen a bit of Lord Arranmore, ... Arranmore, and I'll stake my last shilling that he's not a bad 'un at heart You make it up with him, Brooks Come, that's a straight tip, and it's a good one." Brooks threw away his cigarette and held ... Medchester that he recovered his spirits He knew the place so well that it was easy for him to gauge and appreciate the altered state of affairs there The centre of the town was swept clean at last of...
- 12
- 225
- 0
Lake Trout Ecosystems in a Changing Environment - Chapter 8 doc
Ngày tải lên :
11/08/2014, 10:22
... in Canadian Shield lakes, Canadian Journal of Fisheries and Aquatic Sciences (in press) Dillon, P.J and Molot, L .A. , 1997, Dissolved organic and inorganic carbon mass balances in central Ontario ... trout habitat will require the management of activities in the catchments of lakes that affect DOC inputs to lakes Climate change and acid rain also affect fish habitats by changing DOC concentrations ... small lakes, where even small declines in habitat can threaten fragile populations Additional research and monitoring are needed in several areas because the widespread importance of DOC was...
- 13
- 320
- 0
LANDSCAPE ECOLOGY A Top-Down Approach - Chapter 8 potx
Ngày tải lên :
11/08/2014, 10:22
... Second Law of Thermodynamics In our analog, if an animal wanders into Maxwell's Box, it does not leave The situation is analogous to animals doing a randomwalk search for suitable habitat (the ... on earth appears quite historical by comparison But what of causal closure? If causes other than mechanical or material may be considered, does this not automatically characterize the organic ... physical landscape It is these latter forms that impart shape to the battle The example of a battle also serves to highlight the hierarchical nature of Aristotelean causality All considerations...
- 30
- 296
- 0
Product Design for the Environment: A Life Cycle Approach - Chapter 8 docx
Ngày tải lên :
11/08/2014, 21:21
... Increase ease of disassembly MATERIALS Reduce unsustainable and hazardous materials Increase biodegradable and low-impact materials Reduce material variety Increase material compatibility and ... et al., Materialization and dematerialization: Measures and trends, in Technological Trajectories and the Human Environment, Ausubel, J.H and Langford, H.D., Eds., National Academy Press, Washington, ... Industrial Engineering, 41, 241–260, 2001 Kusiak, A and Lee, G., Design of parts and manufacturing systems for reliability and maintainability, International Journal of Advanced Manufacturing...
- 29
- 311
- 0
Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx
Ngày tải lên :
12/08/2014, 16:20
... cell capacitance STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i HASMs (passage 4–5) were plated in black walled, ... the latter study also implicating a role for STIM2 In particular, STIM1 appears to be a major activator of calcium release activated calcium channels (ICRAC) in T lymphocytes via a mechanism ... (Hertfordshire, UK) Statistical analysis Averaged data are presented as mean ± sem Where appropriate, statistical significance was assessed by unpaired Students T tests or one-way ANOVA followed by the...
- 8
- 341
- 0
valuation for m a Building Value in private companies phần 8 pot
Ngày tải lên :
14/08/2014, 05:21
... Component Value Fair Market Value of a 100% Closely Held Interest on a Control, Marketable Basis Plus: Nonoperating Assets Basis $32,400,000 Control marketable Value Adjusted Fair Market Value of a 100% ... structured as a stock sale and as an asset sale Stock Transaction Generally speaking, in a stock transaction, all of the tangible and intangible assets and all of the liabilities, including unknown and ... within a range, say 10%, of the agreed value at the closing date For example, Sellco has had an average working capital balance of $10 million for the last two years This normalized working capital...
- 31
- 202
- 0